View profile

#240 - Giao thức đồng thuận Kraft

Grokking Vietnam
Grokking Vietnam
Trong số này, chúng ta cùng tìm hiểu về:
  • Grab Engineering đã thực hiện một vài tối ưu nhằm giảm kích thước file JavaScript từ 750kb xuống 250kb như thế nào?
  • Atlassian vừa công bố mức độ availability đạt được của Tenant Context Service (TCS) lên đến 99,9999%.
  • Giao thức đồng thuận (consensus protocol) Kraft.
  • GitHub và Microsoft bị đâm đơn kiện.
  • Cắt giảm nhân sự tại Facebook và những hoảng loạn tại Twitter.
  • Lời giải bài Validate Binary Tree Nodes.
Ngoài ra các bạn vẫn có thể tiếp tục đặt mua ấn phẩm Dijkstra tập 2 để ủng hộ cho các hoạt động của Grokking tại đây.

News
(by lpv)
Mark Zuckerberg’s Message to Meta Employees
The Scoop: Turmoil at Twitter - The Pragmatic Engineer
We’ve filed a law­suit chal­leng­ing GitHub Copi­lot
Những bài viết hay
Góc Lập Trình
Đề ra tuần này: Repeated DNA Sequences
(by ndaadn)
Chuỗi DNA là một chuỗi các phân tử nucleotide được ký hiệu bằng ‘A’, ‘C’, ‘G’, ‘T’. Trong quá trình tìm hiểu về DNA, việc tìm ra những chuỗi phân tử lặp nhau rất hữu dụng. Cho một chuỗi DNA, Hãy tìm tất cả những chuỗi lặp lại có độ dài 10 phân tử.
Ví dụ:
Input: s = “AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT”
Output: [“AAAAACCCCC”,“CCCCCAAAAA”]
Lời giải tuần trước: Validate Binary Tree Nodes
(by phucnh)
Nếu ta biểu diễn các nút của cây dưới dạng đồ thị vô hướng, đồ thị sẽ có n đỉnh, các cạnh của đồ thị biểu diễn quan hệ cha-con của các nút. Theo đề bài, do mỗi nút chỉ có nhiều nhất 2 con, đồ thị tạo thành một cây nhị phân hợp lệ khi:
  • Mỗi nút chỉ được phép có 1 nút cha duy nhất
  • Tất cả các nút phải được liên kết với nhau
  • Đồ thì không chứa chu trình
Ta thực hiện giải thuật như sau: https://pastebin.com/iRY9u0FX
Ta thực hiện giải thuật trên bằng DFS, vì vậy độ phức tạp về thời gian là O(V + E) với V là số đỉnh, E là số cạnh. Với V = n, E xấp xỉ 2n (mỗi nút nối tới tối đa 2 cạnh), độ phức tạp về thời gian là O(n).
History
Vào ngày 5/11/1973, Vint Cerf và Bob Kahn đã submitted một paper mô tả về một giao thức gửi packet qua mạng, mà chúng ta còn gọi với cái tên TCP/IP. Hai ông được công nhận là một trong những “cha đẻ của Internet”.
(by lpv)
Bob Kahn và Vint Cerf - Copyright Will Reintzell 2007
Bob Kahn và Vint Cerf - Copyright Will Reintzell 2007
Code & Tools
  • Blib: a testing tool for seeing your Internet latency and packet loss.
  • Sonic:  a fast, lightweight & schema-less search backend. It is an alternative to Elasticsearch that runs on a few MBs of RAM.
Feedback
Bạn đánh giá nội dung số newsletter này thế nào?
(1 = Rất tệ / 5 = Rất tốt)
👎 1 —— 2 —— 3 —— 4 —— 5 👍
(Việc đánh giá của các bạn là rất quan trọng, sẽ giúp chúng tôi liên tục cải thiện nội dung newsletter tốt hơn)
Grokking mang lại cho các bạn những kiến thức mới mẻ và hữu ích thông qua:
  • Tech Talk: Là một hoạt động thường xuyên của Grokking từ những ngày đầu thành lập. Tại đây các diễn giả chia sẻ kiến thức xoay quanh Computer Science và Software Engineer. Các buổi Tech Talk đều được record và upload lên kênh youtube của Grokking.
  • Grokking Knowledge Graph: Tập hợp những nguồn kiến thức phong phú với hơn 1000 bài viết chọn lọc, các đầu sách, khóa học, v.v… Các bài viết đều được gán nhãn để giúp bạn đọc dễ dàng tìm kiếm.
  • Webinar: Là chương trình kết nối các kỹ sư Việt Nam và các kỹ sư đang làm việc tại các công ty công nghệ hàng đầu thế giới.
  • Dijkstra: Một ấn phẩm được xuất bản bởi các thành viên của Grokking. Với những bài viết đào sâu vào kỹ thuật và kiến thức khoa học máy tính.
  • Kipalog: Nền tảng chia sẻ kiến thức dành cho các lập trình viên.
  • Newsletter: Những bài viết hay về công nghệ sẽ được gửi tới bạn hàng tuần qua email.
Chúc các bạn sẽ tìm được nhiều điều mới mẻ khi đến với Grokking và xin hẹn gặp lại các bạn vào tuần sau.
Quotes
Make it work, make it right, make it fast – Kent Beck
Did you enjoy this issue? Yes No
Grokking Vietnam
Grokking Vietnam

Cảm ơn bạn đã dành thời gian đọc newsletter kỳ này và chúng tôi hi vọng rằng bạn đã khám phá ra một số điều mới mẻ từ các bài viết trên. Các bạn có thể đọc lại các số cũ tại website newsletter.grokking.org

In order to unsubscribe, click here.
If you were forwarded this newsletter and you like it, you can subscribe here.
Created with Revue by Twitter.
Viet Nam